(d)-β-Hydroxybutyrate Inhibits Adipocyte Lipolysis via the Nicotinic Acid Receptor PUMA-G
As a treatment for dyslipidemia, oral doses of 1–3 grams of nicotinic acid per day lower serum triglycerides, raise high density lipoprotein cholesterol, and reduce mortality from coronary heart disease (Tavintharan, S., and Kashyap, M. L. (2001) Curr. Atheroscler. Rep. 3, 74–82). These benefits likely result from the ability of nicotinic acid to inhibit lipolysis in adipocytes and thereby reduce serum non-esterified fatty acid levels (Carlson, L. A. (1963) Acta Med. Scand. 173, 719–722). In mice, nicotinic acid inhibits lipolysis via PUMA-G, a Gi/o-coupled seven-transmembrane receptor expressed in adipocytes and activated macrophages (Tunaru, S., Kero, J., Schaub, A., Wufka, C., Blaukat, A., Pfeffer, K., and Offermanns, S. (2003) Nat. Med. 9, 352–355). The human ortholog HM74a is also a nicotinic acid receptor and likely has a similar role in anti-lipolysis. Endogenous levels of nicotinic acid are too low to significantly impact receptor activity, hence the natural ligands(s) of HM74a/PUMA-G remain to be elucidated. Here we show that the fatty acid-derived ketone body (d)-β-hydroxybutyrate ((d)-β-OHB) specifically activates PUMA-G/HM74a at concentrations observed in serum during fasting. Like nicotinic acid, (d)-β-OHB inhibits mouse adipocyte lipolysis in a PUMA-G-dependent manner and is thus the first endogenous ligand described for this orphan receptor. These findings suggests a homeostatic mechanism for surviving starvation in which (d)-β-OHB negatively regulates its own production, thereby preventing ketoacidosis and promoting efficient use of fat stores. As a treatment for dyslipidemia, oral doses of 1–3 grams of nicotinic acid per day lower serum triglycerides, raise high density lipoprotein cholesterol, and reduce mortality from coronary heart disease (Tavintharan, S., and Kashyap, M. L. (2001) Curr. Atheroscler. Rep. 3, 74–82). These benefits likely result from the ability of nicotinic acid to inhibit lipolysis in adipocytes and thereby reduce serum non-esterified fatty acid levels (Carlson, L. A. (1963) Acta Med. Scand. 173, 719–722). In mice, nicotinic acid inhibits lipolysis via PUMA-G, a Gi/o-coupled seven-transmembrane receptor expressed in adipocytes and activated macrophages (Tunaru, S., Kero, J., Schaub, A., Wufka, C., Blaukat, A., Pfeffer, K., and Offermanns, S. (2003) Nat. Med. 9, 352–355). The human ortholog HM74a is also a nicotinic acid receptor and likely has a similar role in anti-lipolysis. Endogenous levels of nicotinic acid are too low to significantly impact receptor activity, hence the natural ligands(s) of HM74a/PUMA-G remain to be elucidated. Here we show that the fatty acid-derived ketone body (d)-β-hydroxybutyrate ((d)-β-OHB) specifically activates PUMA-G/HM74a at concentrations observed in serum during fasting. Like nicotinic acid, (d)-β-OHB inhibits mouse adipocyte lipolysis in a PUMA-G-dependent manner and is thus the first endogenous ligand described for this orphan receptor. These findings suggests a homeostatic mechanism for surviving starvation in which (d)-β-OHB negatively regulates its own production, thereby preventing ketoacidosis and promoting efficient use of fat stores. Ketone bodies (acetone, acetoacetate (AcAc), 1The abbreviations used are: AcAc, acetoacetate; (d)-β-OHB, (d)-β-hydroxybutyrate; NEFA, non-esterified fatty acid; GTPγS, guanosine 5′-O-(3-thiotriphosphate). 1The abbreviations used are: AcAc, acetoacetate; (d)-β-OHB, (d)-β-hydroxybutyrate; NEFA, non-esterified fatty acid; GTPγS, guanosine 5′-O-(3-thiotriphosphate).and (d)-β-OHB) are produced in the liver from acetyl-CoA derived from β-oxidation of fatty acids (7Laffel L. Diabetes/Metabolism Res. Rev. 1999; 15: 412-426Crossref PubMed Google Scholar). AcAc and (d)-β-OHB are small water-soluble carboxylic acids that are important energy sources for the brain and other tissues during prolonged fasting (10Cahill G.F. N. Engl. J. Med. 1970; 282: 668-675Crossref PubMed Google Scholar). In humans, the serum concentration of (d)-β-OHB is typically ∼50 μm after a meal, rises to ∼0.2–0.4 mm after an overnight fast, reaches ∼1–2 mm after 2–3 days of fasting, and plateaus at ∼6–8 mm upon prolonged starvation (7Laffel L. Diabetes/Metabolism Res. Rev. 1999; 15: 412-426Crossref PubMed Google Scholar, 8Fukao T. Lopaschuk G.D. Mitchell G.A. Prostaglandins Leukotrienes Essent. Fatty Acids. 2004; 70: 243-251Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar, 9Senior B. Loridan L. Nature. 1968; 219: 83-84Crossref PubMed Scopus (55) Google Scholar, 11Owen O.E. Reichard Jr., G.A. Isr. J. Med. Sci. 1975; 11: 560-570PubMed Google Scholar). β-OHB infusion into rats (12Bates M.W. Linn L.C. Metabolism. 1976; 25: 685-695Abstract Full Text PDF PubMed Scopus (10) Google Scholar), pancreatomized dogs (13Bjorntorp P. Schersten T. Am. J. Physiol. 1967; 212: 683-687Crossref PubMed Scopus (32) Google Scholar), and humans (9Senior B. Loridan L. Nature. 1968; 219: 83-84Crossref PubMed Scopus (55) Google Scholar, 14Van Hove J.L. Grunewald S. Jaeken J. Demaerel P. Declercq P.E. Bourdoux P. Niezen-Koning K. Deanfeld J.E. Leonard J.V. Lancet. 2003; 361: 1433-1435Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar) lowers serum NEFAs in vivo, and β-OHB inhibits lipolysis in primary rat (15Bjorntorp P. J. Lipid Res. 1966; 7: 621-626Abstract Full Text PDF PubMed Google Scholar, 16Bjorntorp P. Metabolism. 1966; 15: 191-193Abstract Full Text PDF PubMed Scopus (9) Google Scholar) or bovine (17Metz S.H. Lopes-Cardozo M. van den Bergh S.G. FEBS Lett. 1974; 47: 19-22Crossref PubMed Scopus (22) Google Scholar) adipocytes, whereas AcAc does not. The fact that these effects are similar to those of nicotinic acid and that both β-OHB and nicotinic acid are small carboxylic acids led us to investigate whether ketone bodies are HM74a agonists. Materials—With the exception of Acifran and lithium (dl)-β-OHB, all compounds tested were from Sigma. Acifran was synthesized by chemists at Arena Pharmaceuticals, and lithium (dl)-β-OHB was made by titrating free (dl)-β-OHB acid (Sigma) with LiOH by chemists at Merck. [35S]GTPγS (1160 Ci/mmol) was from Amersham Biosciences, and [5,6-3H]nicotinic acid (50 Ci/mmol) was from American Radiolabeled Chemical (St. Louis, MO). Molecular Cloning—HM74a and HM74 were cloned by PCR using human genomic DNA as a template and the following primers, GCTGGAGCATTCACTAGGCGAG (sense for HM74a), AGATCCTGGTTCTTGGTGACAATG (antisense for HM74a), GGAGAATTCACTAGGCGAGGCGCTCCATC (sense for HM74), and GGAGGATCCAGGAAACCTTAGGCCGAGTCC (antisense for HM74). PUMA-G was cloned using mouse genomic DNA as template, the sense primer AGATCCACTCATGAGCAAGTCAGACC, and the antisense primer CCTTCTTGTCATAGTAACTTAACGAG. For the generation of stable cell lines, 5 × 106 CHO-K1 cells were transfected with 12 μg of plasmid DNA (pCDNA3.1, Invitrogen) containing either HM74a, HM74, or PUMA-G expressed from the cytomegalovirus promoter. Two days after transfection, the growth medium was supplemented with 400 μg/ml G418 to select for antibiotic-resistant cells. Clonal CHO-K1 cell lines that stably express HM74, HM74a, or PUMA-G were selected based on the ability of nicotinic acid (HM74a and PUMA-G) or S711589 (an Arena HM74-specific agonist; data not shown) to inhibit forskolin-induced cAMP production. Calcium Mobilization—CHO-K1 cells expressing an NFAT-β-lactamase reporter and the promiscuous Gα subunit Gqi5 (kind gift of K. Sullivan, Merck Research Laboratories) were stably transfected with either empty vector (pCDNA3.1, Invitrogen) or vector expressing PUMA-G, HM74a, or HM74. Cells were seeded at 10,000 cells/well in 384-well culture plates and grown overnight at 37 °C, 5% CO2 in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 2 mm l-glutamine, 10 mm HEPES, pH 7.4, 0.1 mm MEM non-essential amino acids solution, 1 mm sodium pyruvate, 0.6 mg/ml hygromycin B, 0.5 mg/ml zeocin, and 1 mg/ml geneticin (BD Biosciences). Cells were washed four times with Hanks' balanced salt solution containing 10 mm HEPES, pH 7.4, and loaded with calcium-sensitive dye by incubating with an equal volume of Molecular Devices calcium assay kit loading buffer at 37 °C for 1 h. Calcium response in the fluorometric imaging plate reader assay was measured according to the directions from Molecular Devices. [35S]GTPγS Binding Assay—Membranes from untransfected CHO-K1 cells or cells stably expressing PUMA-G, HM74a, or HM74 (20 μg/assay) were diluted in assay buffer (20 mm HEPES, pH 7.4, 100 mm NaCl, 10 mm MgCl2) in Wallac Scintistrip plates and preincubated with test compounds diluted in assay buffer containing 40 μm GDP (final [GDP] was 10 μm) for ∼10 min before addition of [35S]GTPγS to 0.3 nm. To measure the agonist activity of free acids, rather than sodium salts (Table I), the HEPES concentration was increased to 60 mm; this increase had no effect on the EC50 of nicotinic acid (data not shown). Binding was allowed to proceed for 1 h before centrifuging the plates at 4000 rpm for 15 min at room temperature and subsequent counting in a Packard TopCount scintillation counter. Non-linear regression analysis of the binding curves was performed in GraphPad Prism version 4.Table ILigand-induced [35S]GTPγS binding to membranes from CHO cells expressing PUMA-G, HM74α, or HM74CompoundEC50PUMA-GHM74aHM74μmNicotinic acid0.04 ± 0.0030.10 ± 0.005>100aSome compounds displayed activity at the highest concentration tested but not over a full dose response from which an EC50 could be determined. Therefore, the EC50 for these compounds is denoted as greater than the highest concentration tested.Acifran0.36 ± 0.031.13 ± 0.067.04 ± 0.6Lithium (dl)-β-hydroxybutyrate727 ± 40793 ± 60>25,000Sodium (d)-β-hydroxybutyrate318 ± 37767 ± 57>25,000Sodium (l)-β-hydroxybutyrate684 ± 1191662 ± 382>25,000Lithium acetoacetate>25,000>25,000>25,000AcetoneInactiveInactiveInactiveSodium (dl)-α-hydroxybutyrate>10,000Inactive>10,000Sodium lactate>10,000InactiveInactiveSodium acetate (C2)>10,000>10,000InactiveSodium propionate (C3)>10,000>10,000InactiveSodium butyrate (C4)702 ± 1081590 ± 211InactivePentanoic acid (C5)166 ± 33402 ± 51>10,000Sodium hexanoate (C6)133 ± 15451 ± 91995 ± 246Heptanoic acid (C7)730 ± 1322066 ± 300120 ± 23Sodium octanoate (C8)288 ± 40755 ± 8273 ± 12Sodium decanoate (C10)>10,000>10,000>10,000Oleic acid (C18:1)InactivebFatty acids with >10 carbons were tested at 10 μm only.InactiveInactiveLinoleic acid (C18:2)InactiveInactiveInactiveLinolenic acid (C18:3)InactiveInactiveInactiveArachidonic acid (C20:4)InactiveInactiveInactiveEicosapentaenoic acid (C20:5)InactiveInactiveInactiveDocosahexanoic acid (C22:6)InactiveInactiveInactivea Some compounds displayed activity at the highest concentration tested but not over a full dose response from which an EC50 could be determined. Therefore, the EC50 for these compounds is denoted as greater than the highest concentration tested.b Fatty acids with >10 carbons were tested at 10 μm only. Open table in a new tab [3H]Nicotinic Acid Binding Competition Assay—Assays were performed with the same preparations of membrane used for the [35S]GTPγS assay. Equilibrium binding of [3H]nicotinic acid was done with membranes (30 μg/assay) and test compounds diluted in assay buffer (20 mm HEPES, pH 7.4, 1 mm MgCl2, and 0.01% CHAPS) in a total volume of 200 μl. After 4 h at room temperature, reactions were filtered through Packard Unifilter GF/C plates using a Packard Harvester and washed eight times with 200 μl of ice-cold binding buffer. Nonspecific binding was determined in the presence of 250 μm unlabeled nicotinic acid. Competitive binding assays were performed in the presence of 50 nm [3H]nicotinic acid. In Vitro Lipolysis—Isolation of mouse primary epididymal adipocytes and in vitro determination of NEFA release was performed according to the method of Rodbell as adapted by Tunaru et al. (3Tunaru S. Kero J. Schaub A. Wufka C. Blaukat A. Pfeffer K. Offermanns S. Nat. Med. 2003; 9: 352-355Crossref PubMed Scopus (657) Google Scholar, 23Rodbell M. J. Biol. Chem. 1964; 239: 375-380Abstract Full Text PDF PubMed Google Scholar). To ask whether β-OHB is a ligand for HM74a, we used Chinese hamster ovary (CHO) cells that stably express the chimeric G-protein α subunit Gqi5 (18Conklin B.R. Farfel Z. Lustig K.D. Julius D. Bourne H.R. Nature. 1993; 363: 274-276Crossref PubMed Scopus (606) Google Scholar) and harbor either a control vector or vectors that expresses either HM74a or its paralog HM74, which is 95% identical at the amino acid level to HM74a but has ∼1000-fold less affinity for nicotinic acid (4Wise A. Foord S.M. Fraser N.J. Barnes A.A. Elshourbagy N. Eilert M. Ignar D.M. Murdock P.R. Steplewski K. Green A. Brown A.J. Dowell S.J. Szekeres P.G. Hassall D.G. Marshall F.H. Wilson S. Pike N.B. J. Biol. Chem. 2003; 278: 9869-9874Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar, 5Soga T. Kamohara M. Takasaki J. Matsumoto S. Saito T. Ohishi T. Hiyama H. Matsuo A. Matsushime H. Furuichi K. Biochem. Biophys. Res. Commun. 2003; 303: 364-369Crossref PubMed Scopus (285) Google Scholar). Use of Gqi5 allows the normally Gi/o-coupled HM74 and HM74a to signal via the Gq pathway leading to Ca+2 mobilization. Nicotinic acid elicited Ca+2 mobilization only in cells expressing HM74a (Fig. 1A). In contrast, Acifran, an agonist on both HM74 and HM74a (4Wise A. Foord S.M. Fraser N.J. Barnes A.A. Elshourbagy N. Eilert M. Ignar D.M. Murdock P.R. Steplewski K. Green A. Brown A.J. Dowell S.J. Szekeres P.G. Hassall D.G. Marshall F.H. Wilson S. Pike N.B. J. Biol. Chem. 2003; 278: 9869-9874Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar), elicited a response from both receptors demonstrating that HM74 was functional and could be used as a specificity control in this assay. Given that ketone bodies can reach millimolar concentrations in serum, we tested these compounds at 15 mm. Both (d)- and (l)-β-OHB, but not acetoacetate or free acetone, elicited a Ca+2 response in cells expressing HM74a but not HM74. Whereas the d-isomer of β-OHB is the sole form encountered in high concentrations physiologically (7Laffel L. Diabetes/Metabolism Res. Rev. 1999; 15: 412-426Crossref PubMed Google Scholar), both d- and l-isomers have been shown to inhibit lipolysis in vitro (17Metz S.H. Lopes-Cardozo M. van den Bergh S.G. FEBS Lett. 1974; 47: 19-22Crossref PubMed Scopus (22) Google Scholar), consistent with the results shown here. Similar results were observed for cells expressing murine PUMA-G (data not shown). Next, we determined the half-maximal concentration (EC50) of β-OHB required to stimulate receptor-mediated guanine nucleotide exchange on Gα using a [35S]GTPγS binding assay with membranes prepared from untransfected CHO cells or CHO cells stably expressing either mouse PUMA-G, human HM74a, or HM74 (Fig. 1B and Table I). Nicotinic acid stimulated [35S]GTPγS binding only in membranes from cells expressing HM74a (EC50 104 ± 5 nm) or the mouse ortholog PUMA-G (EC50 = 43 ± 3 nm), whereas Acifran was active on all three receptors (EC50 = 1127 ± 59 nm for HM74a, 358 ± 30 nm for PUMA-G, and 7039 ± 598 nm for HM74). Racemic (dl)-β-OHB also showed some degree of activity on all receptors; however, it was more potent on HM74a (EC50 = 0.8 ± 0.06 mm) and its ortholog PUMA-G (EC50 = 0.7 ± 0.04 mm) than on HM74. The EC50 for the l-enantiomer was ∼2-fold higher than that of the physiologically relevant d-enantiomer (Table I). Both the sodium and lithium salts of β-OHB were active, indicating that the anion is the active component. Moreover, sodium salts of other small monocarboxylic acids with similar pKa values to β-OHB (α-hydroxybutyrate and lactate) were not significantly active in this assay (Table I). At high concentrations, lithium acetoacetate, but not acetone or lithium chloride, elicited [35S]GTPγS binding to all three receptors but not to membranes from untransfected cells, suggesting that acetoacetate is a weak agonist of these receptors. Short-chain fatty acids were recently identified as ligands for the G-protein-coupled receptor GPR41, which is, like HM74a/PUMA-G, expressed in adipocytes (19Le Poul E. Loison C. Struyf S. Springael J.Y. Lannoy V. Decobecq M.E. Brezillon S. Dupriez V. Vassart G. Van Damme J. Parmentier M. Detheux M. J. Biol. Chem. 2003; 278: Full Text Full Text PDF PubMed Scopus Google Scholar, N. K. T. M. Sci. S. A. 2004; PubMed Scopus Google Scholar, A.J. S.M. Barnes A.A. Eilert L. D. Fraser N.J. Pike N.B. Steplewski Murdock P.R. Marshall F.H. Szekeres P.G. Wilson S. Ignar D.M. Foord S.M. A. Dowell S.J. J. Biol. Chem. 2003; 278: Full Text Full Text PDF PubMed Scopus Google Scholar). Given to we determined whether small fatty acids are ligands for a was observed for fatty acids of (Table I), with and acids the active on HM74a EC50 = ± EC50 = ± μm) and PUMA-G EC50 = ± EC50 = ± 15 HM74 has affinity for fatty acids, with a of activity on acid EC50 = ± 12 Table I). it is that these small fatty acids reach concentrations in serum to these receptors (19Le Poul E. Loison C. Struyf S. Springael J.Y. Lannoy V. Decobecq M.E. Brezillon S. Dupriez V. Vassart G. Van Damme J. Parmentier M. Detheux M. J. Biol. Chem. 2003; 278: Full Text Full Text PDF PubMed Scopus Google Scholar), and low affinity for PUMA-G/HM74a and HM74 is not physiologically with both HM74a/PUMA-G and have similar the receptor has at higher affinity for these acids (Table and N. K. T. M. Sci. S. A. 2004; PubMed Scopus Google Scholar). as that in (dl)-β-OHB was not a agonist at concentrations to 10 mm N. K. T. M. Sci. S. A. 2004; PubMed Scopus Google Scholar). of which was not to be only a weak (EC50 mm) ligand of human and receptor for fatty acids expressed in (19Le Poul E. Loison C. Struyf S. Springael J.Y. Lannoy V. Decobecq M.E. Brezillon S. Dupriez V. Vassart G. Van Damme J. Parmentier M. Detheux M. J. Biol. Chem. 2003; 278: Full Text Full Text PDF PubMed Scopus Google Scholar). β-OHB was not an agonist of T. T. PubMed Scopus Google Scholar), the receptor to HM74a/PUMA-G (data not shown). an [3H]nicotinic acid binding assay to ask whether nicotinic acid and β-OHB for the same binding on the receptor. [3H]Nicotinic acid specifically and to membranes from cells expressing HM74a, but not HM74 (data not with a of ± nm (data not a in with results (3Tunaru S. Kero J. Schaub A. Wufka C. Blaukat A. Pfeffer K. Offermanns S. Nat. Med. 2003; 9: 352-355Crossref PubMed Scopus (657) Google Scholar, A. Foord S.M. Fraser N.J. Barnes A.A. Elshourbagy N. Eilert M. Ignar D.M. Murdock P.R. Steplewski K. Green A. Brown A.J. Dowell S.J. Szekeres P.G. Hassall D.G. Marshall F.H. Wilson S. Pike N.B. J. Biol. Chem. 2003; 278: 9869-9874Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar). with unlabeled nicotinic acid a of ± similar to the observed (Fig. As in the [35S]GTPγS binding AcAc displayed low affinity for HM74a, but (dl)-β-OHB the receptor with physiologically relevant affinity = 0.7 ± 0.06 mm; Similar results were observed for PUMA-G = 0.7 mm ± 0.1 mm; data not shown). these data show that (d)-β-OHB is a HM74a/PUMA-G agonist and that the serum concentrations of this ketone body observed as as 2–3 days into a in humans (7Laffel L. Diabetes/Metabolism Res. Rev. 1999; 15: 412-426Crossref PubMed Google Scholar, 8Fukao T. Lopaschuk G.D. Mitchell G.A. Prostaglandins Leukotrienes Essent. Fatty Acids. 2004; 70: 243-251Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar) result in receptor and with adipocytes from that PUMA-G the effect of nicotinic acid (3Tunaru S. Kero J. Schaub A. Wufka C. Blaukat A. Pfeffer K. Offermanns S. Nat. Med. 2003; 9: 352-355Crossref PubMed Scopus (657) Google we performed with Both nicotinic acid and sodium (d)-β-OHB free fatty acid from primary adipocytes from mice, the at concentrations consistent with the affinity determined EC50 for lipolysis was as nicotinic acid and (d)-β-OHB were effect in adipocytes from PUMA-G (Fig. from PUMA-G were not to lipolysis per as fatty acid in and cells (Fig. The also lipolysis in and cells (data not shown). that the of both and lipolysis was lower in adipocytes from with those from (Fig. and is that this is to a of in the adipocytes, as and cells had the same as determined by (data not and and had the same fat as determined by In this we have shown that the ketone body (d)-β-OHB specifically to and activates the HM74a/PUMA-G with an affinity that is the of serum concentrations observed for this after days of starvation in humans and ∼1–2 days in (7Laffel L. Diabetes/Metabolism Res. Rev. 1999; 15: 412-426Crossref PubMed Google Scholar, G.F. N. Engl. J. Med. 1970; 282: 668-675Crossref PubMed Google Scholar). The effect of (d)-β-OHB is, like nicotinic acid, S. Curr. Atheroscler. Rep. PubMed Scopus Google Scholar, Acta Med. Scand. PubMed Scopus Google Scholar, N.B. A. Curr. 2004; Google Scholar). (d)-β-OHB is thus the first endogenous ligand described for the orphan receptor the of ketone body is at by the of adipocyte lipolysis (7Laffel L. Diabetes/Metabolism Res. Rev. 1999; 15: 412-426Crossref PubMed Google Scholar). (d)-β-OHB is suggests a homeostatic mechanism in which this regulates its own by the serum level of fatty acid for in a of the serum effect of β-OHB into humans, and Loridan (9Senior B. Loridan L. Nature. 1968; 219: 83-84Crossref PubMed Scopus (55) Google Scholar) that during starvation ketone bodies of own by adipocyte a mechanism fat during starvation and of from lipolysis and that PUMA-G higher of lipolysis and during a fast, as (d)-β-OHB does not inhibit lipolysis in the of this receptor. In we have not observed and PUMA-G in of body fat or serum levels of NEFA or (d)-β-OHB during and h of fasting. M. and A. we that adipocytes from are to with (Fig. suggesting a in lipolysis in the cells that for of with of PUMA-G in on this of Merck Research for of lithium and at Arena for of Tunaru of the of for with PUMA-G and for fasting with and and of Merck Research for on the and of this