TAK1 Mitogen-activated Protein Kinase Kinase Kinase Is Activated by Autophosphorylation within Its Activation Loop

TAK1, a member of the mitogen-activated kinase kinase kinase family, is activated in vivo by various cytokines, including interleukin-1 (IL-1), or when ectopically expressed together with the TAK1-binding protein TAB1. However, this molecular mechanism of activation is not yet understood. We show here that endogenous TAK1 is constitutively associated with TAB1 and phosphorylated following IL-1 stimulation. Furthermore, TAK1 is constitutively phosphorylated when ectopically overexpressed with TAB1. In both cases, dephosphorylation of TAK1 renders it inactive, but it can be reactivated by preincubation with ATP. A mutant of TAK1 that lacks kinase activity is not phosphorylated either following IL-1 treatment or when coexpressed with TAB1, indicating that TAK1 phosphorylation is due to autophosphorylation. Furthermore, mutation to alanine of a conserved serine residue (Ser-192) in the activation loop between kinase domains VII and VIII abolishes both phosphorylation and activation of TAK1. These results suggest that IL-1 and ectopic expression of TAB1 both activate TAK1 via autophosphorylation of Ser-192. TAK1, a member of the mitogen-activated kinase kinase kinase family, is activated in vivo by various cytokines, including interleukin-1 (IL-1), or when ectopically expressed together with the TAK1-binding protein TAB1. However, this molecular mechanism of activation is not yet understood. We show here that endogenous TAK1 is constitutively associated with TAB1 and phosphorylated following IL-1 stimulation. Furthermore, TAK1 is constitutively phosphorylated when ectopically overexpressed with TAB1. In both cases, dephosphorylation of TAK1 renders it inactive, but it can be reactivated by preincubation with ATP. A mutant of TAK1 that lacks kinase activity is not phosphorylated either following IL-1 treatment or when coexpressed with TAB1, indicating that TAK1 phosphorylation is due to autophosphorylation. Furthermore, mutation to alanine of a conserved serine residue (Ser-192) in the activation loop between kinase domains VII and VIII abolishes both phosphorylation and activation of TAK1. These results suggest that IL-1 and ectopic expression of TAB1 both activate TAK1 via autophosphorylation of Ser-192. mitogen-activated protein kinases MAPK kinase MAPKK kinase MAPKKK kinase extracellular signal-regulated kinase c-Jun N-terminal kinase MAPK/ERK kinase MEK kinase mixed lineage kinase hematopoietic progenitor kinase/germinal center kinase-like kinase tumor necrosis factor interleukin-1 nuclear factor-κB hemagglutinin polyacrylamide gel electrophoresis N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine The mitogen-activated protein kinases (MAPKs)1 are a family of serine/threonine kinases that have been shown to function in a wide variety of biological processes (1.Davis R.J. Trends Biochem. Sci. 1994; 19: 470-473Abstract Full Text PDF PubMed Scopus (918) Google Scholar, 2.Su B. Karin M. Curr. Opin. Immunol. 1996; 8: 402-411Crossref PubMed Scopus (721) Google Scholar, 3.Treisman R. Curr. Opin. Cell Biol. 1996; 8: 205-215Crossref PubMed Scopus (1165) Google Scholar). MAPKs are activated by phosphorylation of specific tyrosine and threonine residues by a family of dual-specificity protein kinase MAPK kinases (MAPKKs). MAPKKs are, in turn, activated by phosphorylation of serine and serine/threonine residues by MAPKK kinases (MAPKKKs) (4.Cobb M.H. Goldsmith E.J. J. Biol. Chem. 1995; 270: 14843-14846Abstract Full Text Full Text PDF PubMed Scopus (1663) Google Scholar, 5.Fanger G.R. Gerwins P. Widmann C. Jarpe M.B. Johnson G.L. Curr. Opin. Genet. Dev. 1997; 7: 67-74Crossref PubMed Scopus (299) Google Scholar, 6.Robinson M.J. Cobb M.H. Curr. Opin. Cell Biol. 1997; 9: 180-186Crossref PubMed Scopus (2286) Google Scholar). Three distinct members of the MAPK family have been identified: extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38. Whereas the ERK family is activated by growth factors and is involved in cell proliferation, JNK and p38 are activated in response to proinflammatory cytokines and various types of environmental stresses. ERK family kinases are activated by the MEK1 and MEK2 MAPKKs; JNK by MKK4 and MKK7; and p38 by MKK3 and MKK6. Further upstream, Raf-1 functions as a MAPKKK in the ERK activation pathway. A subgroup of MAPKKKs including the MEKK family (MEKK1, MEKK2, MEKK3, and MEKK4/MTK1), the MLK family (MLK1, MLK2, MLK3, and DLK), ASK1, and TAK1 activate the MAPKKs that phosphorylate JNK and p38, but not the MAPKKs that phosphorylate ERK (5.Fanger G.R. Gerwins P. Widmann C. Jarpe M.B. Johnson G.L. Curr. Opin. Genet. Dev. 1997; 7: 67-74Crossref PubMed Scopus (299) Google Scholar, 6.Robinson M.J. Cobb M.H. Curr. Opin. Cell Biol. 1997; 9: 180-186Crossref PubMed Scopus (2286) Google Scholar). Different mechanisms activate MAPKKKs. Autophosphorylation mediated by an intramolecular reaction has been implicated in the activation of MEKK1 and Ssk2, a MAPKKK in budding yeast (7.Deak J.C. Templeton D.J. Biochem. J. 1997; 322: 185-192Crossref PubMed Scopus (61) Google Scholar, 8.Siow Y.L. Kalmar G.B. Sanghera J.S. Tai G. Oh S.S. Pelech S.L. J. Biol. Chem. 1997; 272: 7586-7594Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 9.Posas F. Saito H. EMBO J. 1998; 17: 1385-1394Crossref PubMed Scopus (252) Google Scholar). ASK1 and MLK3 have been demonstrated to form dimers in response to upstream stimuli, an event important for their catalytic activities (10.Leung I.W. Lassam N. J. Biol. Chem. 1998; 273: 32408-32415Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 11.Gotoh Y. Cooper J.A. J. Biol. Chem. 1998; 273: 17477-17482Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar). This dimerization may facilitate intermolecular autophosphorylation leading to activation, as is the case for receptor tyrosine kinases. In some signaling pathways, MAPKKKs may be activated by the action of upstream MAPKKK kinases (MAPKKKKs). For example, in the budding yeast mating pheromone pathway, MAPKKKK Ste20 functions to activate MAPKKK Ste11 (12.Herskowitz I. Cell. 1995; 80: 187-197Abstract Full Text PDF PubMed Scopus (867) Google Scholar). Similarly, Ste20-like kinases have been implicated in the activation of MAPKKKs in mammalian cells. For example, Raf-1 is phosphorylated and activated by p21 (Rac/Cdc42)-activated kinase (13.King A.J. Sun H. Diaz B. Barnard D. Miao W. Bagrodia S. Marshall M.S. Nature. 1998; 396: 180-183Crossref PubMed Scopus (386) Google Scholar). Germinal center kinase functions upstream of MEKK1 in the tumor necrosis factor (TNF) signaling pathway leading to JNK activation (14.Yuasa T. Ohno S. Kehrl J.H. Kyriakis J.M. J. Biol. Chem. 1998; 273: 22681-22692Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar); and hematopoietic progenitor kinase and hematopoietic progenitor kinase/germinal center kinase-like kinase (HGK) are involved in the activation of TAK1 that leads to JNK activation (15.Wang W. Zhou G. Hu M. Yao Z. Tan T.H. J. Biol. Chem. 1997; 272: 22771-22775Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar, 16.Yao Z. Zhou G. Wang X.S. Brown A. Diener K. Gan H. Tan T.H. J. Biol. Chem. 1999; 274: 2118-2125Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). TAK1 is a member of the MAPKKK family and is activated by various cytokines, including transforming growth factor-β family ligands and interleukin-1 (IL-1) (17.Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1178) Google Scholar, 18.Shirakabe K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar). We have previously demonstrated that TAK1 functions in transforming growth factor-β signaling pathways in mammalian cells (17.Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1178) Google Scholar). In early Xenopus embryos, TAK1 also participates in mesoderm induction and patterning meditated by bone morphogenetic protein, a transforming growth factor-β family ligand (19.Yamaguchi K. Nagai S. Ninomiya T.J. Nishita M. Tamai K. Irie K. Ueno N. Nishida E. Shibuya H. Matsumoto K. EMBO J. 1999; 18: 179-187Crossref PubMed Scopus (326) Google Scholar, 20.Shibuya H. Iwata H. Masuyama N. Gotoh Y. Yamaguchi K. Irie K. Matsumoto K. Nishida E. Ueno N. EMBO J. 1998; 17: 1019-1028Crossref PubMed Scopus (191) Google Scholar). Furthermore, we have recently demonstrated that TAK1 is involved in the IL-1 signaling pathway by activating two kinase cascades (21.Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar); one is a MAPK cascade leading to JNK activation, and the other is a kinase cascade composed of nuclear factor-κB (NF-κB)-inducing kinase and IκB kinases, ultimately leading to NF-κB activation. TAB1 is a mammalian protein that interacts with TAK1 and was identified in a yeast two-hybrid screen (22.Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (524) Google Scholar). When ectopically expressed together with TAK1, TAB1 can augment the kinase activity of TAK1. The C-terminal 68-amino acid portion of TAB1 is sufficient for binding to and activation of TAK1. However, the molecular mechanism for this activation remains to be elucidated. In this report, we sought to determine the mechanism for both IL-1- and TAB1-induced activation of TAK1. We found that endogenous TAK1 associates with TAB1 constitutively and is activated by autophosphorylation following IL-1 stimulation. Similarly, ectopically expressed TAK1, once bound to TAB1, is also activated by autophosphorylation. The primary site of TAK1 autophosphorylation is Ser-192 in the kinase activation loop. Phosphorylation of this residue correlates with activation of TAK1. 293 and 293IL-1RI (23.Cao Z. Henzel W.J. Gao X. Science. 1996; 271: 1128-1131Crossref PubMed Scopus (777) Google Scholar) cells were maintained in Dulbecco's modified Eagle's medium supplemented with fetal calf serum (10%) at 37 °C and 5% CO2. The mammalian expression vectors for TAB1, N-terminal hemagglutinin (HA) epitope-tagged TAK1, and TAB1 (pEF-TAB1, pEF-HA-TAK1, pEF-HA-TAK1(K63W), and pEF-HA-TAB1) have been described previously (17.Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1178) Google Scholar,18.Shirakabe K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 22.Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (524) Google Scholar). Several TAK1 mutants (TAK1(S192A), TAK1(S192D), and TAK1(S192E)) that contain various substitutions of a serine residue in the activation loop were generated by polymerase chain reaction. First, a 5′-oligonucleotide containing a SacI restriction site (TTGTGGAGCTCCGGCAGTTG) together with a 3′-oligonucleotide containing aNarI restriction site (TTCAGGCGCCATCCAAGCAGCAGCCCC for TAK1(S192A), TTCAGGCGCCATCCAAGCAGCATCCCC for TAK1(S192D), or TTCAGGCGCCATCCAAGCAGCTTCCCC for TAK1(S192E)) were used to generate TAK1 mutant fragments. The resulting DNA fragments were digested with SacI and NarI and subcloned into the SacI and NarI sites of pSP72-HA-TAK1, which contains an N-terminal HA epitope-tagged full-length TAK1 cDNA fragment in the EcoRI and BamHI sites of the vector pSP72 (Promega). The mutations were verified by DNA sequencing. Next, the EcoRI-BamHI TAK1 mutant fragments were cloned into the EcoRI and BamHI sites of the vector pEF to generate pEF-HA-TAK1 mutants. To generate the TAK1 C-terminal truncation constructs, EcoRI-PstI fragments from pEF-HA-TAK1 or pEF-HA-TAK1(K63W), containing the N-terminal HA epitope-tagged 402 of TAK1, were into the EcoRI and sites of the vector K. Matsumoto K. A. Cell. Biol. 9: PubMed Scopus Google Scholar) to a the fragments from the containing the HA epitope-tagged TAK1 cDNA and a were into the EcoRI and sites of the pEF and 293IL-1RI cells were either or with IL-1 for For the 293 or 293IL-1RI cells were in with a of of DNA containing various expression and for were once with and in of containing and was by at for from cell were with of or and of protein The were with For the or cell were by gel electrophoresis and to The were with various and the bound was with to or the TAK1 or various ectopically expressed of were with or as described were with or of expressed T. N. Yamaguchi K. Gotoh Y. Irie K. T. Shirakabe K. Y. Shibuya H. Matsumoto K. Nishida E. M. J. Biol. Chem. 1996; 271: Full Text Full Text PDF PubMed Scopus Google Scholar) in of kinase containing and of at °C for were by and by For were with in containing and at °C for were with the described and with were with a containing and at 37 °C for were with were to an in phosphorylation as described was and phosphorylated in with as described The were by and to The phosphorylated was identified by and digested with PubMed Scopus Google Scholar). The resulting were by gel electrophoresis polyacrylamide H. G. Biochem. PubMed Scopus Google Scholar). and a generated by of phosphorylated in with IκB kinase (21.Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar) were used as molecular activity were as described (21.Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar). was used to A containing the the of the was used for To TAK1 is activated following IL-1 we endogenous TAK1 in and cells. 293 cells the IL-1 receptor were with and cell were to with and with and TAK1 kinase activity was also in expressed as an TAK1 was activated IL-1 as previously K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar). that TAB1 with TAK1 in both and cells and that TAB1 constitutively associates with TAK1. However, TAK1 and TAB1 were found to when cells were with with that are the of phosphorylation and Next, to TAK1 activity correlates with phosphorylation of TAK1 and TAB1, we dephosphorylation TAK1 kinase were with with a containing and for TAK1 activity in treatment of the TAK1 the of TAK1 to phosphorylate indicating that dephosphorylation TAK1 kinase activity and The were with of and for kinase This treatment in the of the of TAK1 and TAB1 in both and cells. the kinase activity of TAK1 was phosphorylation of TAK1 and TAB1 correlates with activation of TAK1. These results suggest that IL-1 TAK1 via phosphorylation of a We have previously shown that TAK1 has kinase activity when ectopically expressed but is activated when TAB1 is coexpressed K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 22.Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (524) Google Scholar). We TAB1 ectopically expressed TAK1. We expressed or together with TAB1 in 293 cells. Cell were to with and in When expressed as a and with TAB1 a in This of TAK1 by TAB1 was by the induction of TAK1 kinase activity was not when TAK1 was ectopically expressed but was when TAK1 and TAB1 were coexpressed and These results the that TAB1-induced activation of ectopically expressed TAK1 is mediated by as is activation of endogenous TAK1 by of the TAK1 with both the of TAK1 and kinase activity When from cells TAK1 and TAB1 were and with of TAK1 was and kinase activity was TAB1-induced activation of TAK1 correlates with phosphorylation of TAK1. When was expressed in 293 to and with it was found to be modified activated In endogenous TAK1 was modified and activated following in cells not with IL-1 The between two is that endogenous TAK1 was found to be constitutively associated with TAB1, of the ectopically expressed was found of TAK1 with TAB1 may be for phosphorylation and activation of TAK1. This is to be sufficient for activation of TAK1 in TAK1 is activated when TAB1 is the other endogenous TAK1 remains it constitutively a with TAB1. is that of TAK1 and TAB1 the of IL-1 by the of some shown in phosphorylation of endogenous TAB1 with TAK1 Similarly, phosphorylation of ectopically expressed TAB1 also with TAK1 activity and When was ectopically expressed and a of endogenous TAB1 was found to This associated TAB1 kinase activity for results is that the portion of that is bound to endogenous TAB1 is in but is to be by kinase with this a portion of from cells not TAB1 was also to phosphorylation of TAK1 be mediated by autophosphorylation or by phosphorylation in by protein These two be by a mutant of TAK1 is phosphorylated IL-1 kinase is for TAK1 TAK1 be phosphorylated in response to In autophosphorylation is TAK1 not be We a mutant of TAK1 generated by a in the site with 293IL-1RI cells or were or were with and HA epitope-tagged were with with IL-1 in a in the of to was with endogenous TAK1 In IL-1 the of indicating that TAK1 kinase activity is for phosphorylation These results suggest that TAK1 is IL-1 We the TAB1-induced of TAK1 is also mediated by autophosphorylation. We expressed together with TAB1 in 293 cells. The and TAB1 were with and form of TAK1 was when was coexpressed with TAB1 and with TAB1 TAK1 autophosphorylation In the of TAB1 were not when TAB1 was coexpressed with the TAK1 and This that phosphorylation of TAB1 is also mediated by TAK1. The activation of protein kinases, including the phosphorylation of serine threonine residues in a the kinase activation loop between VII and VIII D.J. Cell. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar). For example, of MEKK1 and of budding yeast Ssk2, both the activation are for their autophosphorylation and activation (7.Deak J.C. Templeton D.J. Biochem. J. 1997; 322: 185-192Crossref PubMed Scopus (61) Google Scholar, 8.Siow Y.L. Kalmar G.B. Sanghera J.S. Tai G. Oh S.S. Pelech S.L. J. Biol. Chem. 1997; 272: 7586-7594Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 9.Posas F. Saito H. EMBO J. 1998; 17: 1385-1394Crossref PubMed Scopus (252) Google Scholar). shown in Ser-192 of TAK1 to of MEKK1 and of we this residue to alanine and the resulting mutant protein was phosphorylated IL-1 treatment or by with TAB1. was expressed in 293IL-1RI and was by with We found that the of this mutant was by IL-1 treatment or of TAB1 To Ser-192 is for TAK1 kinase we to phosphorylate MKK6. In to TAK1, kinase activity was when the mutant was coexpressed with TAB1 These results show that Ser-192 is important for both IL-1- and TAB1-induced autophosphorylation and activation of TAK1 and is the site for autophosphorylation. To the phosphorylation at in activated TAK1, we used gel electrophoresis to TAK1 or was coexpressed with TAB1 in 293 cells and with The were with and digested with of TAB1 phosphorylation of of TAK1 containing a of two fragments of TAK1 are to one is which contains and and the is which not contain or tyrosine of Ser-192 phosphorylation of the we that Ser-192 is a phosphorylation site of activated TAK1. has been shown for some kinases that residues in the activation loop with results in the of a constitutively mutant D.J. Cell. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar). We generated mutants of TAK1 in which Ser-192 was with acid or acid or and their kinase activities with that of TAK1. We found that mutant TAK1 kinase when coexpressed together with TAB1 not These results suggest that the molecular by phosphorylation of Ser-192 in TAK1 be by with We have previously demonstrated that TAK1 NF-κB via the kinase cascade (21.Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar). To that phosphorylation of Ser-192 is for NF-κB activation, we the of TAK1 mutants activation an We expressed an together with or various mutants of TAK1. previously (21.Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google TAK1 expression when coexpressed with TAB1. In of the and mutants in kinase activity activated when coexpressed with TAB1. Ser-192 is also important for activation of Autophosphorylation can by either an or intermolecular reaction. To between we an HA epitope-tagged mutant of TAK1 that lacks of the TAK1 but contains the kinase can be from by We expressed or the mutant of together with as an of TAK1. In was to by TAK1. Cell were to with kinase when coexpressed with and phosphorylated was both and When was coexpressed with the mutant and and but not when was coexpressed with the mutant and TAB1, and TAB1 but not autophosphorylation of TAK1 is an intramolecular reaction. The mechanisms by which MAPKKKs are activated are elucidated. In cases, activation phosphorylation of MAPKKKs. In some signaling pathways, phosphorylation of MAPKKKs is mediated by other protein kinases as Ste20-like In other cases, autophosphorylation is implicated in the activation of MAPKKKs. In this we demonstrated that autophosphorylation of TAK1 is important for IL-1- and TAB1-induced activation of TAK1. to alanine of which in the activation loop between VII and abolishes both IL-1- and TAB1-induced phosphorylation of TAK1. Furthermore, this mutation a form of TAK1 that is in to phosphorylate or to activate we that Ser-192 is the site of TAK1 autophosphorylation and is for catalytic In we also Ser-192 with acid or acid in an to the resulting from However, mutations the of kinase have been for mutants in and MEKK1 Y.L. Kalmar G.B. Sanghera J.S. Tai G. Oh S.S. Pelech S.L. J. Biol. Chem. 1997; 272: 7586-7594Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, J.M. S. S. Cobb M.H. J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar). This that the molecular of phosphorylated Ser-192 in TAK1 is important for catalytic a Ste20-like has been implicated in the activation of TAK1 leading to JNK activation Z. Zhou G. Wang X.S. Brown A. Diener K. Gan H. Tan T.H. J. Biol. Chem. 1999; 274: 2118-2125Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). is a serine/threonine and JNK activation is by a mutant of TAK1, but not by a mutant of is activated by and may function as an upstream kinase for TAK1 in signaling that TAK1 is activated by a variety of extracellular stimuli, including transforming growth and environmental K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Abstract Full Text Full Text PDF PubMed Scopus (300) Google it not be that TAK1 is by may activate TAK1 via IL-1 TAK1 via autophosphorylation. it be to determine TAK1 by phosphorylation of to TAK1 is in response to Autophosphorylation of a kinase may be mediated by either an or intramolecular reaction. of intermolecular autophosphorylation is the activation of receptor tyrosine kinases J. Curr. Biol. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar). ligand form and phosphorylate their resulting in activation of the mechanisms of activation have been described for MAPKKKs as ASK1 and MLK3 (10.Leung I.W. Lassam N. J. Biol. Chem. 1998; 273: 32408-32415Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 11.Gotoh Y. Cooper J.A. J. Biol. Chem. 1998; 273: 17477-17482Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar). In response to upstream stimuli, both MLK3 and ASK1 form and are Furthermore, are when overexpressed upstream stimuli, due to dimerization resulting from This is not the case for TAK1, which has kinase activity when overexpressed Furthermore, we have shown here that autophosphorylation of TAK1 by an intramolecular reaction. In we two epitope-tagged of TAK1 and was not with in cells or in cells with TAB1. it that the activation of TAK1 not Similarly, autophosphorylation by an intramolecular reaction has been for MEKK1 and (7.Deak J.C. Templeton D.J. Biochem. J. 1997; 322: 185-192Crossref PubMed Scopus (61) Google Scholar, 9.Posas F. Saito H. EMBO J. 1998; 17: 1385-1394Crossref PubMed Scopus (252) Google Scholar). The autophosphorylation sites of TAK1, and are at their activation In the case of TAK1, we have demonstrated that protein, TAB1, is for autophosphorylation and activation. autophosphorylation of also the protein which functions as an upstream of F. Saito H. EMBO J. 1998; 17: 1385-1394Crossref PubMed Scopus (252) Google Scholar). TAK1, Ssk2, and MEKK1 may be by a activation suggest that are at two mechanisms for MAPKKK activation that intermolecular autophosphorylation and intramolecular autophosphorylation. IL-1 a in proinflammatory to IL-1 are mediated by cascades of signaling including activation of NF-κB as as activation of JNK 1996; PubMed Google Scholar). binding of IL-1 to the IL-1 is from the IL-1 receptor to an protein, factor Z. J. M. T. Nature. 1996; PubMed Scopus Google Scholar). of the cells to TAK1 is to the factor it activated (21.Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar). TAK1 a MAPK cascade leading to JNK activation and an kinase cascade leading to NF-κB activation. We have demonstrated here that TAK1 is activated via autophosphorylation in response to IL-1 TAK1 endogenous TAK1 constitutively associates with TAB1, it remains and in the of IL-1 stimulation. binding of TAB1 to TAK1 is not sufficient to phosphorylation and activation of endogenous TAK1 in the other ectopically expressed TAK1 is activated by with TAB1 in the of Furthermore, when endogenous from cells are in with TAK1 is phosphorylated and binding of TAB1 to TAK1 to be sufficient for activation in These results the that a factor the activity of the endogenous in the of IL-1 stimulation. IL-1 treatment may this and autophosphorylation and activation of TAK1 to Further to this of TAK1 be We E. Nishida for and M. and R. for of the

TAK1 Mitogen-activated Protein Kinase Kinase Kinase Is Activated by Autophosphorylation within Its Activation Loop | Litlas