SIRT1 Modulation of the Acetylation Status, Cytosolic Localization, and Activity of LKB1
SIRT1, a histone/protein deacetylase, and AMP-activated protein kinase (AMPK) are key enzymes responsible for longevity and energy homeostasis. We examined whether a mechanistic connection exists between these molecules that involves the major AMPK kinase LKB1. Initial studies demonstrated that LKB1 is acetylated in cultured (HEK293T) cells, mouse white adipose tissue, and rat liver. In the 293T cells, SIRT1 overexpression diminished lysine acetylation of LKB1 and concurrently increased its activity, cytoplasmic/nuclear ratio, and association with the LKB1 activator STRAD. In contrast, short hairpin RNA for SIRT1, where studied, had opposite effects on these parameters. Mass spectrometric analysis established that acetylation of LKB1 occurs on multiple, but specific, lysine residues; however, only mutation of lysine 48 to arginine, which mimics deacetylation, reproduced all of the effects of activated SIRT1. SIRT1 also affected downstream targets of LKB1. Thus its overexpression increased AMPK and acetyl-CoA carboxylase phosphorylation, and conversely, RNA interference-mediated SIRT1 knockdown reduced AMPK phosphorylation and that of another LKB1 target MARK1. Consistent with the results in cultured cells, total LKB1 lysine acetylation was decreased by 60% in the liver of 48-h starved rats compared with starved-refed rats, and this was associated with modest but significant increases in both LKB1 and AMPK activities. These results suggest that LKB1 deacetylation is regulated by SIRT1 and that this in turn influences its intracellular localization, association with STRAD, kinase activity, and ability to activate AMPK. SIRT1, a histone/protein deacetylase, and AMP-activated protein kinase (AMPK) are key enzymes responsible for longevity and energy homeostasis. We examined whether a mechanistic connection exists between these molecules that involves the major AMPK kinase LKB1. Initial studies demonstrated that LKB1 is acetylated in cultured (HEK293T) cells, mouse white adipose tissue, and rat liver. In the 293T cells, SIRT1 overexpression diminished lysine acetylation of LKB1 and concurrently increased its activity, cytoplasmic/nuclear ratio, and association with the LKB1 activator STRAD. In contrast, short hairpin RNA for SIRT1, where studied, had opposite effects on these parameters. Mass spectrometric analysis established that acetylation of LKB1 occurs on multiple, but specific, lysine residues; however, only mutation of lysine 48 to arginine, which mimics deacetylation, reproduced all of the effects of activated SIRT1. SIRT1 also affected downstream targets of LKB1. Thus its overexpression increased AMPK and acetyl-CoA carboxylase phosphorylation, and conversely, RNA interference-mediated SIRT1 knockdown reduced AMPK phosphorylation and that of another LKB1 target MARK1. Consistent with the results in cultured cells, total LKB1 lysine acetylation was decreased by 60% in the liver of 48-h starved rats compared with starved-refed rats, and this was associated with modest but significant increases in both LKB1 and AMPK activities. These results suggest that LKB1 deacetylation is regulated by SIRT1 and that this in turn influences its intracellular localization, association with STRAD, kinase activity, and ability to activate AMPK. LKB1 is a serine-threonine protein kinase that phosphorylates and activates 13 downstream kinases (1Alessi D.R. Sakamoto K. Bayascas J.R. Annu. Rev. Biochem. 2006; 75: 137-163Crossref PubMed Scopus (637) Google Scholar), one of which is AMP-activated protein kinase (AMPK), 2The abbreviations used are: AMPK, AMP-activated protein kinase; GST, glutathione S-transferase; GFP, green fluorescent protein; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; LC-MS/MS, liquid chromatography/tandem mass spectrometry; LDS, lithium dodecyl sulfate; HRP, horseradish peroxidase; shRNA, short hairpin RNA; ACC, acetyl-CoA carboxylase; RNAi, RNA interference; WT, wild type. a key enzyme that regulates cellular energy state, growth, inflammation, and mitochondrial function (2Ruderman N. Prentki M. Nat. Rev. Drug Discov. 2004; 3: 340-351Crossref PubMed Scopus (377) Google Scholar). LKB1, when not associated with other proteins, is located predominantly in the nucleus because of its N-terminal nuclear localization signal. However, LKB1 activation takes place predominantly in the cytoplasm, after it complexes with STRAD (STE-related adapter) and MO25 (mouse protein 25) (1Alessi D.R. Sakamoto K. Bayascas J.R. Annu. Rev. Biochem. 2006; 75: 137-163Crossref PubMed Scopus (637) Google Scholar, 3Boudeau J. Baas A.F. Deak M. Morrice N.A. Kieloch A. Schutkowski M. Prescott A.R. Clevers H.C. Alessi D.R. EMBO J. 2003; 22: 5102-5114Crossref PubMed Scopus (356) Google Scholar). Once activated, LKB1 has been demonstrated to phosphorylate AMPK on Thr-172, an event required for its activation (4Sanders M.J. Grondin P.O. Hegarty B.D. Snowden M.A. Carling D. Biochem. J. 2007; 403: 139-148Crossref PubMed Scopus (528) Google Scholar). On the other hand, no specific mechanism for regulating the activation and inactivation of the kinase activity of LKB1 has been described. Indeed, it has been suggested that LKB1 may be constitutively active and that its effects on AMPK phosphorylation (e.g. in contracting muscle) may be governed by the action of phosphatases (1Alessi D.R. Sakamoto K. Bayascas J.R. Annu. Rev. Biochem. 2006; 75: 137-163Crossref PubMed Scopus (637) Google Scholar, 20Hardie D.G. Hawley S.A. Scott J.W. J. Physiol. (Lond.). 2006; 574: 7-15Crossref Scopus (651) Google Scholar). SIRT1, a class III NAD+-dependent histone/protein deacetylase, has been implicated in the longevity induced by caloric restriction in species ranging from Caenorhabditis elegans to rodents (5Sinclair D.A. Guarente L. Sci. Am. 2006; 294 (54-47): 48-51Crossref PubMed Scopus (106) Google Scholar). It has been suggested that it may work in part by activating AMPK (5Sinclair D.A. Guarente L. Sci. Am. 2006; 294 (54-47): 48-51Crossref PubMed Scopus (106) Google Scholar). The expression and deacetylation activities of SIRT1 are enhanced by increases in NAD+ levels or the NAD+/NADH ratio, such as occur during caloric restriction (5Sinclair D.A. Guarente L. Sci. Am. 2006; 294 (54-47): 48-51Crossref PubMed Scopus (106) Google Scholar, 6Rodgers J.T. Lerin C. Haas W. Gygi S.P. Spiegelman B.M. Puigserver P. Nature. 2005; 434: 113-118Crossref PubMed Scopus (2584) Google Scholar). In the investigations described here, we present evidence that SIRT1 deacetylates LKB1 and that this is associated with its movement to the cytoplasm where it is bound to and activated by STRAD. The data also suggest that SIRT1 activates AMPK by this mechanism both in cultured HEK293T cells and in rat liver in vivo. Cell Cultures—Human embryonic kidney 293T cells (HEK293T) and HepG2 cells were purchased from the ATCC (Manassas, VA). The cells were maintained in either Opti-MEM I reduced serum medium (Invitrogen) for 293T or Dulbecco's modified Eagle's medium for HepG2 cells supplemented with 5–10% fetal bovine serum and antibiotics. Antibodies—The following primary antibodies were used: total AMPK-α and phospho-Thr-172-AMPK (Cell Signaling Technology, Danvers, MA); glutathione S-transferase (GST), LKB1 (N-19, H-75, M-18, and Ley37D/G6), SIRT1, STRAD, and phospho-Ser-428 LKB1 (Santa Cruz Biotechnologies; Santa Cruz, CA); acetyl-CoA carboxylase (ACC), phospho-Ser-79-ACC, acetyl-lysine (Millipore/Upstate, Charlottesville, VA); β-actin, FLAG tag (Sigma); and phospho-Thr-336-LKB1 (ImmuQuest; Ingleby Barwick, Cleveland, UK). The following secondary antibodies were used: HRP-conjugated donkey anti-rabbit antibody, HRP-conjugated sheep anti-mouse antibody (Amersham Biosciences); HRP-conjugated rabbit anti-goat antibody, and HRP conjugated rabbit anti-sheep antibody (Chemicon, Temecula, CA). cDNAs and Plasmids—The following is a list of cDNA accession numbers used in this study. Unless stated otherwise, the plasmids were purchased from ATCC. They include LKB1 (STK11), BC007981 (HIP human kinase collection, DF/HCC DNA Resource Core; Boston, MA); STRAD (LYK5 isoform 4), BC081911; MO25 (CAB39, calcium-binding protein 39), BC020570; SirT1, NM_019812 (Upstate). These cDNAs were subcloned by PCR to produce in-frame fusion expression plasmids. The forward cloning primers start at the ATG site, and the reverse cloning primers end at the stop codon. Each primer has a length of ∼20–25 bp and has a calculated Tm of 60 °C. The 5′-end of the forward and reverse primers also contained additional sequences (forward, GGCTTTAAAGGAACC, and reverse, AAGCTGGGTCTAGAT) so that the cloned cDNAs could undergo in vitro homologous ligation with In-Fusion system plasmids (Clontech). After 18 cycles of PCR with proofreading KOD hot start polymerase (Novagen; San Diego), the PCR product was gel-purified (Qiagen; Valencia, CA), cut with XmnI and EcoRV (Invitrogen), and ligated with the pENTR1A vector that had been cut with the same restriction endonucleases. Subsequently, these entry vectors (in which the target gene is flanked by L1 and L2 Gateway sequences) were incubated with the LR enzyme (Invitrogen) and with pDEST27 (N-terminal GST), pDEST26 (N-terminal His), or pDEST53 (N-terminal GFP) to generate fusion proteins tagged with GST, His, or GFP, respectively. Site-directed Mutagenesis—Site-directed LKB1 mutagenesis was performed by PCR. Essentially, the PCR mixture containing MgCl2, dNTP, and 10× PCR buffer was given 125 ng each of the respective forward and reverse mutation generating primers, 10 ng of template wtLKB1 pENTR vector, and 2 units of KOD proofreading DNA polymerase. The PCR was performed with the following parameters: 95 °C for 30 s, 60 °C for1 min, and 72 °C for 2 min for 18 cycles. After PCR, 20 units of DpnI (New England Biolabs, Ipswich, MA) were added to the mix and incubated at 37 °C for 1 h. The DpnI treatment digests only the original methylated template DNA leaving the newly synthesized unmethylated mutated DNA. The digested PCR mix was transformed into Top10 Escherichia coli. The plasmids were purified, and the mutations were confirmed by sequencing. The following is a list of primers used to make LKB1 mutations: K44R forward, 5′-CGC CGC AAG CGG GCC AGG CTC ATC GGC AAG TAC-3′, and reverse, 5′-GTA CTT GCC GAT GAG CCT GGC CCG CTT GCG GCG-3′; K48R forward, 5′-GCC AAG CTC ATC GGC AGG TAC CTG ATG GGG GAC-3′, and reverse, 5′-GTC CCC CAT CAG GTA CCT GCC GAT GAG CTT GGC-3′; K96R forward, 5′-AAC GGG GAG GCC AAC GTG AGG AAG GAA ATT CAA CTA CTG-3′, and reverse, 5′-CAG TAG TTG AAT TTC CTT CCT CAC GTT GGC CTC CCC GTT-3′; K97R forward, 5′-GGG GAG GCC AAC GTG AAG AGG GAA ATT CAA CTA CTG AGG-3′, and reverse, 5′-CCT CAG TAG TTG AAT TTC CCT CTT CAC GTT GGC CTC CCC-3′. The SirT1 H335Y mutation was made in a similar way by using following primers: forward, 5′-C CAA AGG ATC CTT CAG TGT TAT GGT TCC TTT GCA ACA GCA TC-3′, and reverse, 5′-GA TGC TGT TGC AAA GGA ACC ATA ACA CTG AAG GAT CCT TTG G-3′. Creation of Plasmids Expressing GST Fusion LKB1 Fragment Proteins—Indicated fragments of LKB1 were made by PCR with LKB1 (BC007981) as the template and with the following primers: LKB1-(1–44) forward, 5′-CACC ATG GAG GTG GTG GAC CCG-3′, and reverse, 5′-T TCG ACC CAG ATC TA CTA CT TGG CCC GCTT GCG-3′; LKB1-(45–90) forward, 5′-CACC CTC ATC GGC AAG TAC CTG-3′, and reverse 5′-CTA GTT GGG GAT CCT TCG-3′; LKB1-(189–318) forward, 5′-CACC CTC AAA ATC TCC GAC CTG-3′, and reverse, 5′-T TCG ACC CAG ATC TA CTA TGC TTC AGC CGG AGG-3′; and LKB1-(189–433) forward, 5′-CACC CTC AAA ATC TCC GAC CTG-3′, and reverse, 5′-T TCG ACC CAG ATC TA CTA CAA CTG CTG CTT GCA GGC-3′. PCR products were gel-purified and ligated directly into pENTR/D-TOPO vector (Invitrogen). After confirming sequences, GST fusion protein expression vectors were created by LR reaction with pDEST27 vector. Short Hairpin RNA Expressing Lentivirus—The sequence GTATTGCTGAACAGATGGAA was chosen as a potential target sequence for shRNA-mediated RNAi of human sirt1. The pSilencer 2.0 vector (Ambion; Austin, TX) was used as the template for the human U6 promoter that was cloned using the following PCR primers: forward primer (5′-GAATTCCCCAGTGGAAAGACGC-3′) and reverse primer (5′-GGTGTTTCGTCCTTTCCACAAGATATATAAAGGG-3′). An shRNA expression cassette was created by tandem polymerase reaction of the U6 promoter template with one forward and two reverse primers as follows: forward, 5′-CACCGCGCGCCAAGGTCGGGCA-3′, and reverse 1, 5′-CTACACAAACTCCACCTGTTCAGCAATACGGTGTTTCGTCC-3′ and reverse 2 5′-CCAAAAAAGTATTGCTGAACAGATGGAACTACACAAACTC-3′, which contains two GU pairing mutations in the sense strand. The resulting PCR product was inserted into pCR8-GW-TOPO (Invitrogen) and then by LR reaction to shRNA expression of the was with 10 of of and 2 of vectors into 293T cells in a the were 48 10 of containing was The was then and by at for min after of It was with of and were at °C The 293T cells or HepG2 cells in were by each with of vector and for h. the cells were 72 RNAi of SIRT1 was performed by either and purchased from or of shRNA human sirt1. The effects were 72 after of of Fusion in and of of plasmids containing tagged was performed with San or the in 293T The of DNA was of a the cells were with buffer containing 20 1 1 1 1 1 10 1 and 10 the were by at for min and then incubated at °C with (Amersham The were with buffer containing 20 and The proteins were with of LDS, LKB1 LKB1 was with the LKB1 antibody and protein The reaction was by of kinase buffer containing 1 10 of and into containing the After at 30 °C for 10 or 20 min, was and was by liquid LKB1 activities were similar way on SIRT1 of LKB1 in in of buffer that with the SIRT1 was incubated for 30 min at 30 °C with SIRT1 1 After with buffer LKB1 was with LKB1 to the of LKB1 is to that of the reduced of the LKB1 antibody with protein or C. D.R. J. PubMed Google was performed to the from the of the LKB1 antibody rabbit LKB1 antibody mouse adipose or LKB1 rat antibody was incubated with of protein or in at °C for 2 h. After with 1 of and 1 of the were with 1 of 20 in and incubated with for 30 min at After the the were in 1 of for The were with and then with same used for at °C of was by with protein for 2 and then incubated with the LKB1 antibody 293T cells, of were incubated with LKB1 The were with buffer and then with 30 of buffer or of or in with of SIRT1 was into 293T cells on in the cells were with were and fluorescent were for localization analysis of LKB1 using a The of of cytoplasm, and were in and the cytoplasmic/nuclear was Mass fusion proteins were cut into and to with as described D.R. J. 2004; PubMed Scopus Google Scholar). and of the digested were performed at the with rats were either starved for 48 or starved for 48 and for h. the liver was in liquid and at °C used for and LKB1 activity were performed as described. studies were in with by the and were by the using results are as was as and LKB1 and the of by SIRT1 LKB1 from cells and it for total acetylated the acetylated that in to LKB1, we antibodies to protein this was acetylation of LKB1 was in HEK293T cells in which LKB1 was by and with the same but with an LKB1 antibody (Santa Cruz we also acetylation of LKB1 in white adipose of the mouse and in mouse LKB1 was acetylated both in cultured 293T cells and in vivo. the of SIRT1 on LKB1 acetylation LKB1 was with wild SIRT1 and SIRT1 in 293T SIRT1 diminished LKB1 acetylation by SIRT1 a in its acetylation SIRT1 knockdown by shRNA a in LKB1 and with a activator (5Sinclair D.A. Guarente L. Sci. Am. 2006; 294 (54-47): 48-51Crossref PubMed Scopus (106) Google Scholar), for decreased its acetylation by 60% deacetylation of LKB1 by SIRT1 was also in a system in which GST tagged LKB1 was with SIRT1 and its NAD+ was not with GST tag or with the that acetylation was on LKB1 These results suggest that SIRT1 LKB1 SIRT1 LKB1 to STRAD and and of wild SIRT1 in 293T cells increases both STRAD to LKB1 and LKB1 activity, of which were when the SIRT1 was used STRAD to LKB1 was diminished in cells with SIRT1 shRNA of SIRT1 also increased LKB1 phosphorylation at both and of LKB1 activation as be in the protein of LKB1, STRAD, and AMPK-α were not in these not a at SIRT1 LKB1 which of the acetylated lysine on LKB1 a in the of its activity, LKB1 was in 293T cells and to and to its acetylation in and at are acetylated the and and of LKB1. analysis between a of LKB1 fragments and SIRT1 that SIRT1 with LKB1 on the N-terminal of its association was specific, because no was between SIRT1 and a protein In we also an association of LKB1 and SIRT1 in 293T cells by on these we created a of LKB1 in which specific in the N-terminal were to arginine, a that mimics to the effects of a lysine PubMed Scopus Google Scholar). were created at and in GST fusion protein expression plasmids. in in the 293T cells, only the K48R demonstrated increased phosphorylation of LKB1 at and as be deacetylation was an event in LKB1 The K48R of LKB1 also AMPK phosphorylation as because it lysine at it was to SIRT1 overexpression LKB1 activity of the was that of LKB1 when not by SIRT1 In with the of deacetylation in the action of SIRT1, we also that it was in cells incubated with of LKB1 by SIRT1 and K48R of the of we K48R fusion proteins and compared localization to that of LKB1. The studies were both and after SIRT1. of SIRT1 increased the cytoplasmic/nuclear of LKB1. In contrast, the K48R LKB1 was in the cytoplasm, and this was not by SIRT1 and increased localization of both LKB1 and the K48R was when STRAD was that STRAD levels in these cells The of the was similar to that of cells the it was not affected by SIRT1. these results that deacetylation at is a key event in LKB1 phosphorylation, and SIRT1 of of AMPK at was increased by overexpression of SIRT1 and conversely, of for SIRT1 the phosphorylation of AMPK and its acetyl-CoA carboxylase In we that the phosphorylation of another LKB1 was by SIRT1 knockdown in HepG2 cells LKB1 and in by activity was and its total acetylation was 60% in the liver of rats starved for 48 in the liver of starved-refed this in LKB1 activity was associated with a in and as described Prentki M. Am. J. Physiol. 2005; PubMed Scopus Google Scholar). The of this are that LKB1 be by SIRT1 and that in HEK293T cells such deacetylation with increases in LKB1 activity, localization, and to STRAD, and AMPK and ACC In contrast, of SIRT1 with RNAi diminished LKB1 to STRAD and the phosphorylation of both AMPK and another LKB1 MARK1. We also that similar increases in LKB1 deacetylation and activity and AMPK activation occur in rat liver in during a in which activation of SIRT1 has been described J.T. Lerin C. Haas W. Gygi S.P. Spiegelman B.M. Puigserver P. Nature. 2005; 434: 113-118Crossref PubMed Scopus (2584) Google Scholar). we LKB1 acetylation in adipose and that acetylation and deacetylation are regulated in these the evidence that in the acetylation and deacetylation of LKB1 are by SIRT1 and that its activity and that of AMPK. the mechanism by which SIRT1 activates LKB1 and AMPK and is in LKB1 deacetylation to its activation is LKB1 exists in both the nucleus and of cells, and its activation and movement to the place when it to STRAD MO25 and a that to be constitutively active (1Alessi D.R. Sakamoto K. Bayascas J.R. Annu. Rev. Biochem. 2006; 75: 137-163Crossref PubMed Scopus (637) Google Scholar). We that the deacetylation of LKB1 is associated with increases in its activity, cytoplasmic/nuclear ratio, and its to STRAD. with 293T cells containing mutations of lysine to the effects of suggested that is a major that these However, the that SIRT1 overexpression or mutation of to not in total movement of LKB1 to the cytoplasm that deacetylation is not the LKB1 expression of STRAD enhanced the localization of LKB1 and the K48R LKB1 STRAD levels to be for this to the between acetylation and the STRAD mechanism that has been to LKB1 movement into and of the nucleus J. PubMed Scopus Google be at in the on LKB1 by protein kinases such as protein kinase and protein kinase and at both of which occur after LKB1 is activated (1Alessi D.R. Sakamoto K. Bayascas J.R. Annu. Rev. Biochem. 2006; 75: 137-163Crossref PubMed Scopus (637) Google Scholar), were used as of LKB1 activation in the present study. at these is not for LKB1 kinase activation (1Alessi D.R. Sakamoto K. Bayascas J.R. Annu. Rev. Biochem. 2006; 75: 137-163Crossref PubMed Scopus (637) Google the of mouse LKB1 that the sequence is active and to phosphorylate AMPK. J. M. N. and the of each of these phosphorylation is phosphorylation has been to such as Kieloch A. Morrice N. Deak M. Alessi D.R. J. PubMed Scopus Google Scholar), M. L. 2007; PubMed Scopus Google Scholar), and the cellular localization and activation of AMPK D. PubMed Scopus Google Scholar). The results suggest that SIRT1 knockdown AMPK phosphorylation and however, it has been that cells from SIRT1 either no J. Sci. A. 2007; PubMed Scopus Google or an in AMPK activity L. J. M. Sci. A. PubMed Scopus Google Scholar). is because of an associated with RNAi, because we two RNAi and both the same is that an energy in SIRT1 cells L. J. M. Sci. A. PubMed Scopus Google the of LKB1 In of this it has been that SIRT1 is associated with constitutively expression and a of by L. A. J. M. M. A. Guarente L. 2006; PubMed Scopus Google Scholar). In this we of SIRT1, and no in and levels was 72 that the cells were on SIRT1 and its ability to LKB1. other or class I or a similar is not In of this these and SIRT1 to target proteins as is by both SIRT1 (5Sinclair D.A. Guarente L. Sci. Am. 2006; 294 (54-47): 48-51Crossref PubMed Scopus (106) Google and Cell 2007; PubMed Scopus Google Scholar). it is that in cells other SIRT1 produce the in LKB1 described In this and J. Sci. A. 2007; PubMed Scopus Google demonstrated that activate AMPK in cells and that LKB1 is required for this to occur when SIRT1 is The that another SIRT1 in activating LKB1 in these cells has not been however, has been to activate in cells K. Biochem. 2007; PubMed Scopus Google Scholar). studies to whether LKB1 activation increases in AMPK activity been in or during or with or The that LKB1 activity was not in these to the that it is constitutively active D.G. Hawley S.A. Scott J.W. J. Physiol. (Lond.). 2006; 574: 7-15Crossref Scopus (651) Google Scholar). The results of this suggest that these effects may be we that in rat LKB1 activity and acetylation could be by and a of SIRT1 in these to be in with an knockdown of SIRT1, suggest that during a associated with increased SIRT1 activity J.T. Lerin C. Haas W. Gygi S.P. Spiegelman B.M. Puigserver P. Nature. 2005; 434: 113-118Crossref PubMed Scopus (2584) Google Scholar), deacetylation of LKB1 may be a key of the The for the for LKB1 activation in and liver is it has been that AMPK activation by both SIRT1 and LKB1 in HepG2 cells and mouse liver K. K. M. J. PubMed Scopus Google Scholar). The results of this a mechanism for this that SIRT1, by the deacetylation of LKB1, to its activation and that of AMPK. whether this mechanism is studies as the of the in which it in vivo. with