Cloning, Characterization, and Chromosomal Location of a Novel Human K+-Cl− Cotransporter

Differential display polymerase chain reaction has been used to isolate genes regulated in vascular endothelial cells by the angiogenic factor vascular endothelial cell growth factor (VEGF). Analysis of one of the bands consistently up-regulated by VEGF led us to the identification of a cDNA from a human umbilical vein endothelial cell library that is 77% identical to the human K+-Cl− cotransporter1 (KCC1). We have referred to the predicted protein as K+-Cl−cotransporter 3 (KCC3). Hydrophobicity analysis of the KCC3 amino acid sequence showed an almost identical pattern to KCC1, suggesting 12 membrane-spanning segments, a large extracellular loop with potentialN-glycosylation sites, and cytoplasmic N- and C-terminal regions. The KCC3 mRNA was highly expressed in brain, heart, skeletal muscle, and kidney, showing a distinct pattern and size from KCC1 and KCC2. The KCC3 mRNA level in endothelial cells increased on treatment with VEGF and decreased with the proinflammatory cytokine tumor necrosis factor α, whereas KCC1 mRNA levels remained unchanged. Stable overexpression of KCC3 cDNA in HEK293 cells produced a glycoprotein of approximately 150 kDa, which was reduced to 120 kDa by glycosidase digestion. An increased initial uptake rate of86Rb was seen in clones with high KCC3 expression, which was dependent on extracellular Cl− but not Na+and was inhibitable by the loop diuretic agent furosemide. The KCC3 genomic localization was shown to be 15q13 by fluorescence in situ hybridization. Radiation hybrid analysis placed KCC3 within an area associated with juvenile myoclonic epilepsy. These results suggest KCC3 is a new member of the KCC family that is under distinct regulation from KCC1. Differential display polymerase chain reaction has been used to isolate genes regulated in vascular endothelial cells by the angiogenic factor vascular endothelial cell growth factor (VEGF). Analysis of one of the bands consistently up-regulated by VEGF led us to the identification of a cDNA from a human umbilical vein endothelial cell library that is 77% identical to the human K+-Cl− cotransporter1 (KCC1). We have referred to the predicted protein as K+-Cl−cotransporter 3 (KCC3). Hydrophobicity analysis of the KCC3 amino acid sequence showed an almost identical pattern to KCC1, suggesting 12 membrane-spanning segments, a large extracellular loop with potentialN-glycosylation sites, and cytoplasmic N- and C-terminal regions. The KCC3 mRNA was highly expressed in brain, heart, skeletal muscle, and kidney, showing a distinct pattern and size from KCC1 and KCC2. The KCC3 mRNA level in endothelial cells increased on treatment with VEGF and decreased with the proinflammatory cytokine tumor necrosis factor α, whereas KCC1 mRNA levels remained unchanged. Stable overexpression of KCC3 cDNA in HEK293 cells produced a glycoprotein of approximately 150 kDa, which was reduced to 120 kDa by glycosidase digestion. An increased initial uptake rate of86Rb was seen in clones with high KCC3 expression, which was dependent on extracellular Cl− but not Na+and was inhibitable by the loop diuretic agent furosemide. The KCC3 genomic localization was shown to be 15q13 by fluorescence in situ hybridization. Radiation hybrid analysis placed KCC3 within an area associated with juvenile myoclonic epilepsy. These results suggest KCC3 is a new member of the KCC family that is under distinct regulation from KCC1. cation chloride cotransporter sodium potassium chloride cotransporter potassium chloride cotransporter vascular endothelial cell growth factor human umbilical vein endothelial cell polymerase chain reaction tumor necrosis factor α kilobase(s) The cation chloride cotransporter (CCC)1 family is involved in the electroneutral movement of ions across the plasma membrane. There are three CCC subclasses identified thus far on the basis of their structures, ligands, and inhibitors. These are the thiazide-sensitive Na+-Cl− cotransporters, the loop diuretics-sensitive Na+-K+-Cl−(NKCC), and the K+-Cl− cotransporters (KCC; Refs. 1Gamba G. Saltzberg S.N. Lombardi M. Miyanoshita A. Lytton J. Hediger M.A. Brenner B.M. Herbert S.C. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 2749-2753Crossref PubMed Scopus (345) Google Scholar, 2Gamba G. Miyanoshita A. Lombardi M. Lytton J. Lee W.S. Hediger M.A. Herbert S.C. J. Biol. Chem. 1994; 269: 17713-17722Abstract Full Text PDF PubMed Google Scholar, 3Xu J.C. Lytle C. Zhu T.T. Payne J.A. Benz Jr., E. Forbush III, B. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2201-2205Crossref PubMed Scopus (375) Google Scholar, 4Gillen C.M. Brill S. Payne J.A. Forbush III., B. J. Biol. Chem. 1996; 271: 16237-16244Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar, 5Payne J.A. Stevenson T.J. Donaldson L.F. J. Biol. Chem. 1996; 271: 16245-16252Abstract Full Text Full Text PDF PubMed Scopus (468) Google Scholar). NKCC and KCC have two isotypes. NKCC1 shows ubiquitous distribution (3Xu J.C. Lytle C. Zhu T.T. Payne J.A. Benz Jr., E. Forbush III, B. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2201-2205Crossref PubMed Scopus (375) Google Scholar) among organs, whereas NKCC2 is restricted to kidney (2Gamba G. Miyanoshita A. Lombardi M. Lytton J. Lee W.S. Hediger M.A. Herbert S.C. J. Biol. Chem. 1994; 269: 17713-17722Abstract Full Text PDF PubMed Google Scholar). KCC1 is ubiquitous (4Gillen C.M. Brill S. Payne J.A. Forbush III., B. J. Biol. Chem. 1996; 271: 16237-16244Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar), whereas KCC2 is only found in brain (5Payne J.A. Stevenson T.J. Donaldson L.F. J. Biol. Chem. 1996; 271: 16245-16252Abstract Full Text Full Text PDF PubMed Scopus (468) Google Scholar). In addition to the classical roles of transepithelial salt transport (6Haas M. Am. J. Physiol. 1994; 267: C869-C885Crossref PubMed Google Scholar) and the regulation of cellular volume (7Lauf P.K. Bauer J. Adragna N.C. Fujise H. Zade-Oppen A.M.M. Ryu K.H. Delpire E. Am. J. Physiol. 1992; 263: C917-C932Crossref PubMed Google Scholar), Harling et al. (8Harling H. Czaja I. Shell J. Walden R. EMBO J. 1997; 16: 5855-5866Crossref PubMed Scopus (25) Google Scholar) have recently shown that tobacco protoplast growth becomes independent of the plant hormone, auxin, when NKCC1 is overexpressed, suggesting the possible involvement of the CCC family in cell cycle regulation. The physiological regulation of the NKCC and KCC family is complex. Other than the electrochemical gradient of their ligands, evidence suggests that activation of this passive transport system is regulated by phosphorylation (9Krarup T. Jakobsen L.D. Jensen B.S. Hoffmann E.K. Am. J. Physiol. 1998; 275: C239-C250Crossref PubMed Google Scholar), cytoskeletal rearrangement (10Matthews J.B. Awtrey C.S. Madara J.L. J. Clin. Invest. 1992; 90: 1608-1613Crossref PubMed Scopus (88) Google Scholar), change of intracellular Mg2+ concentration (6Haas M. Am. J. Physiol. 1994; 267: C869-C885Crossref PubMed Google Scholar, 7Lauf P.K. Bauer J. Adragna N.C. Fujise H. Zade-Oppen A.M.M. Ryu K.H. Delpire E. Am. J. Physiol. 1992; 263: C917-C932Crossref PubMed Google Scholar), intracellular pH (11Zade-Oppen A.M.M. Lauf P.K. J. Membr. Biol. 1990; 118: 143-151Crossref PubMed Scopus (13) Google Scholar), oxygen concentration (12Gibson J.S. Speake P.F. Ellory J.C. J. Physiol. (Lond.). 1998; 511: 225-234Crossref Scopus (72) Google Scholar), and cellular ATP levels (13Lauf P.K. Am. J. Physiol. 1983; 245: C445-C448Crossref PubMed Google Scholar). In addition, some stimuli can mediate differential effects on various members of the CCC family. For example, cell swelling activates KCC, whereas cell shrinkage activates NKCC (6Haas M. Am. J. Physiol. 1994; 267: C869-C885Crossref PubMed Google Scholar, 7Lauf P.K. Bauer J. Adragna N.C. Fujise H. Zade-Oppen A.M.M. Ryu K.H. Delpire E. Am. J. Physiol. 1992; 263: C917-C932Crossref PubMed Google Scholar). Phosphorylation activates NKCC, whereas KCC is activated by dephosphorylation (6Haas M. Am. J. Physiol. 1994; 267: C869-C885Crossref PubMed Google Scholar, 7Lauf P.K. Bauer J. Adragna N.C. Fujise H. Zade-Oppen A.M.M. Ryu K.H. Delpire E. Am. J. Physiol. 1992; 263: C917-C932Crossref PubMed Google Scholar). In cultured endothelial cells, transcriptional regulation has been reported for NKCC1 in response to sheer stress and proinflammatory cytokines (14Topper J.N. Wasserman S.M. Anderson K.R. Cai J. Falb D. Gimbrone Jr., M.A. J. Clin. Invest. 1997; 99: 2941-2949Crossref PubMed Scopus (56) Google Scholar). Cellular differentiation has also been shown to be associated with changes in NKCC and KCC gene expression. In the intestinal epithelial cell line HT29, a change of NKCC1 mRNA level during differentiation has been reported (15Matthews J.B. Hassan I. Meng S. Archer S.Y. Hrnjez B.J. Hodin R.A. J. Clin. Invest. 1998; 101: 2072-2079Crossref PubMed Scopus (62) Google Scholar, 16Moore-Hoon M.L. Turner R.J. Biochem. Biophys. Res. Commun. 1998; 244: 15-19Crossref PubMed Scopus (6) Google Scholar), whereas the loss of K+-Cl− flux during the maturation of sheep red blood cells is well known (7Lauf P.K. Bauer J. Adragna N.C. Fujise H. Zade-Oppen A.M.M. Ryu K.H. Delpire E. Am. J. Physiol. 1992; 263: C917-C932Crossref PubMed Google Scholar). We report here the isolation and cloning of a new member of the KCC group of cotransporters, which we have named KCC3. KCC3 displays high homology to KCC1, and the characteristics of the ion flux mediated by KCC3 satisfies the criteria for a KCC. KCC3 is regulated at the mRNA level by the angiogenic factor VEGF and by the proinflammatory cytokine TNFα, neither of which has any effect on KCC1 mRNA levels. Finally, KCC3 has been localized to chromosome 15q13, a region linked to the inherited disease juvenile myoclonic epilepsy (17Elslie F.V. Rees M. Williamson M.P. Kerr M. Kjeldsen M.J. Pang K.A. Sundqvist A. Mögens L.F. Chadwick D. Richens A. Covanis A. Santos M. Arzimanoglou A. Panayiotopoulos C.P. Curtis D. Whitehouse W.P. Gardiner R.N. Hum. Mol. Genet. 1997; 6: 1329-1334Crossref PubMed Scopus (234) Google Scholar). HUVECs were isolated as described previously (18Wall R.T. Harker L.A. Quadracci L.J. Striker G.E. J. Cell. Physiol. 1978; 96: 203-213Crossref PubMed Scopus (130) Google Scholar). The cells were cultured on gelatin-coated culture flasks in medium 199 with Eagle's salts supplemented with 20% fetal calf serum. After passage 1, the cells were grown in medium with 25 μg/ml endothelial cell growth factor (Collaborative Research) and 25 μg/ml heparin (Sigma). For the differential display, HUVECs were cultured in Opti-MEM medium (Life Technologies, Inc.) with 2% fetal calf serum for 2 days. HUVECs grown to approximately 70% confluency in Opti-MEM were stimulated with 50 ng/ml VEGF 165 (R & D Systems) and 25 μg/ml heparin for 4 h. For TNFα stimulation, HUVECs were grown in medium with 20% fetal calf serum and growth factor, then treated for 4 h with 2 ng/ml TNFα (R & D). Primary culture HUVECs with or without VEGF stimulation were lysed by Trizol reagent (Life Technologies, Inc.). Total RNA was extracted using the manufacturer's protocol and was treated with RNA clean kit (Genhunter) to remove genomic DNA contamination. The RNA obtained was reverse-transcribed using three classes of anchor primers provided in the RNA Image Kit (Genhunter), and each of three cDNA pools were amplified on the GeneAmp PCR system 2400 model (Perkin-Elmer) with a combination of eight arbitrary primers and the same anchor primer used in reverse transcription. This resulted in the generation of 24 amplicons from one RNA sample. The primer-matched amplicons were electrophoresed side by side in a 6% acrylamide gel. The bands that were consistently regulated were retrieved from the gel, reamplified, and subcloned into a pGEM-T vector (Promega) to be sequenced using Dye terminator cycle sequence kit and the autosequencer (Perkin-Elmer-Applied Bio). One of the bands consistently up-regulated by VEGF treatment encoded a product whose DNA sequence was 90% identical to human KCC1. We used this sequence as a probe (7AV1 probe) to screen a λgt10/HUVEC library (a gift from Dr. Sawamura, Kyoto University). A 2.7-kb phage clone (clone 3) showed significant homology to KCC1 (U55054 in GenBankTM/EBI data bank). We further screened the library with a 5′ sequence of clone 3 (3R probe, a PCR product using primers 5′-CATTGACGTTTGCTCTAAGACC and 5′-GTTTGATCCAGCCATGATACC, see Fig. 2 A) to obtain a 2.1-kb clone (clone 9) that spanned a putative initiating ATG signal. Clone 3 and clone 9 shared an overlap of 1 kb including a BstB1 site, which enabled us to construct a 3.7-kb cDNA with an open reading frame for a 1099-amino acid protein (see Fig. 2 A, KCC3 protein, cDNA sequence deposited in GenBankTM data base, accession number AF108831). Analysis of the nucleic acid and amino acid sequences was carried out using the programs provided by ANGIS (Australian National Genomic Information Service). Total RNA was extracted from HUVECs of primary and passaged cultures using Trizol reagent. Twenty μg of total RNA was prepared and separated by electrophoresis in a 1% agarose gel containing formaldehyde. RNA was transferred to Hybond N (Amersham Pharmacia Biotech) membrane and UV-cross-linked. To produce a specific KCC3 probe, we generated a 942-base pair PCR product using KCC3-specific primers (GTCCCATCAAAGTTATG and GCAATAGCTTGTAGCAGCCTCG, corresponding to amino acids 349–548). This segment of cDNA was chosen homology to KCC1. After of this product from agarose gel using Kit the was with in the of 1 ng/ml reverse primer to the To produce a probe, and to amino acids were used as and reverse and the same protocol was was carried out with For of a human was to the KCC3-specific A KCC3 cDNA construct was a sequence of was to the N of KCC3 using the primers and to amino acids The PCR generated a PCR product that was with and linked to the of the KCC3 The construct was into the vector which was to HEK293 cells using (Life Technologies, Inc.). HEK293 cells were with μg/ml and were to cells were grown to confluency in with were with flux medium 3 1 1 1 2 pH and and then for at with of flux medium containing 1 One of flux medium containing (Amersham Pharmacia Biotech) was were for 3 3 with For sodium was and for was by and were at the concentration at the of the were lysed with 2% and for protein using a protein kit and using in a KCC 1 and 2 were linked to to and by 1 and by were prepared as described previously S. T. for Scholar). To KCC3 protein by KCC3 was with glycosidase at in the of The KCC3 sequence in the vector was with and in situ at a concentration of ng/ml to from two The fluorescence in situ was from that previously described E. J.A. Genet. 1990; Google Scholar). were analysis with and chromosome For the hybrid we a screen of a medium of clones to the of the KCC3 PCR was carried out on this using primers and of which in the 5′ region of KCC3 PCR results were using the hybrid at the In the differential display PCR using total RNA extracted from a was consistently up-regulated in using three independent pools of primary and passaged HUVECs as RNA A of differential displays is shown in We have this product and generated a cDNA from two clones The cDNA sequence shows high homology to KCC1 and a predicted protein of amino The primary amino acid sequence of this protein, which we have named is 77% identical to KCC1 and identical to KCC2 are found in the large extracellular the and membrane-spanning The of KCC3 was almost identical to that of KCC1, a protein with 12 membrane-spanning and large intracellular N- and C-terminal 2 is to KCC1, in the the extracellular the and membrane-spanning and the and membrane-spanning and in the area the KCC3 not have a acid at the of the This has been to be for the extracellular potassium in KCC2 J.A. Am. J. Physiol. 1997; PubMed Google of the primary of the KCC family amino acids are are the KCC3 phosphorylation and protein phosphorylation are also shown the sequence was using the and programs and were identified with the at Image A shows the of KCC3. expressed KCC1 and of KCC3 was in brain, heart, skeletal muscle, and of approximately and kb were and in Fig. 4 and showed in KCC3 mRNA level increased from as as h VEGF whereas KCC1 levels remained 4 This was not only in primary HUVECs but also in passaged cells not We have also used PCR to the VEGF and have obtained results to the data has been reported that NKCC1 is up-regulated by TNFα (14Topper J.N. Wasserman S.M. Anderson K.R. Cai J. Falb D. Gimbrone Jr., M.A. J. Clin. Invest. 1997; 99: 2941-2949Crossref PubMed Scopus (56) Google the KCC3 mRNA level showed a in response to TNFα, whereas KCC1 remained 4 To further the KCC3 gene we have generated a KCC3 cDNA an We have produced HEK293 cell KCC3. The protein, when with was kDa A, 1 and reduced to 120 kDa by with glycosidase treatment using by with 1 Fig. A, 3 and using by with A, and the same These results were also when we used of not KCC3 protein was also and from cultured HUVECs using We used uptake as a of flux as described (4Gillen C.M. Brill S. Payne J.A. Forbush III., B. J. Biol. Chem. 1996; 271: 16237-16244Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar). the sequence was to the of was uptake KCC3 clones and not the KCC3 construct was used for the analysis of KCC3. of KCC3 in HEK293 cells was in by using The results for 1 clone (clone are shown in results were seen in independent clones not A was used in and uptake was at for the initial not The results shown in Fig. a increased uptake in clone that a high level of KCC3 The of uptake was to that reported for KCC1 (4Gillen C.M. Brill S. Payne J.A. Forbush III., B. J. Biol. Chem. 1996; 271: 16237-16244Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar), of of is to of an was not seen in clones that were but expressed a level of KCC3 not The uptake was dependent on extracellular Cl− with on extracellular The loop and showed a of uptake with than of Fig. D). The KCC3 not a significant in uptake in response to treatment not These results that KCC3 satisfies the criteria of the KCC of from a were for signal. of showed a on one or of chromosome in the region 15q13 There was a total of 2 in 25 A was obtained from of the probe to from a not Radiation hybrid analysis that KCC3 is associated with the chromosome with a of of and using the gene at a with the localization of KCC3 by fluorescence in situ We here the cloning of a new member of the CCC family that is to the potassium chloride cotransporter KCC1 and that we have named KCC3. The amino acid sequence shows significant homology to KCC family members with amino acid KCC1 and KCC3 There is a large predicted extracellular the and putative membrane-spanning that is to the KCC family but not in the NKCC family. is in the and in the extracellular the and and and putative membrane-spanning is also that are in the C-terminal region to KCC1 and KCC3 that are not in KCC2 The C-terminal in as addition of a to the of KCC3 the uptake of in not Harling et al. (8Harling H. Czaja I. Shell J. Walden R. EMBO J. 1997; 16: 5855-5866Crossref PubMed Scopus (25) Google Scholar) that the C-terminal of a plant is for growth of tobacco protoplast of KCC3 in HEK293 cells analysis and that KCC3 characteristics of a flux was increased in KCC3 This was independent of extracellular but dependent on extracellular This and the that the flux was in the of the reagent B. E.K. Am. J. Physiol. PubMed Google Scholar), which NKCC1 but activates KCC (4Gillen C.M. Brill S. Payne J.A. Forbush III., B. J. Biol. Chem. 1996; 271: 16237-16244Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar), suggest that NKCC1 is not a in is also that KCC1 is for the uptake in the increased uptake was only seen in clones high levels of KCC3. in and the mRNA levels of KCC1 were not Analysis of with a KCC3-specific probe showed a pattern with levels in kidney, skeletal muscle, heart, and This with the of KCC1, which is ubiquitous (4Gillen C.M. Brill S. Payne J.A. Forbush III., B. J. Biol. Chem. 1996; 271: 16237-16244Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar), and which is restricted to brain (5Payne J.A. Stevenson T.J. Donaldson L.F. J. Biol. Chem. 1996; 271: 16245-16252Abstract Full Text Full Text PDF PubMed Scopus (468) Google Scholar). the for the distribution is suggests that KCC3 not a as cell volume regulation as has been for KCC1 (4Gillen C.M. Brill S. Payne J.A. Forbush III., B. J. Biol. Chem. 1996; 271: 16237-16244Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar). This is further by the of regulation of KCC3 in response to in not we not the of KCC3 in endothelial the of this gene in HUVECs to VEGF suggests an involvement in is to that the of KCC3 mRNA levels mediated by VEGF be of the which results in changes in cell J. A. M. J. Biol. Chem. 1994; 269: Full Text PDF PubMed Google Scholar). changes have been reported to be one of the initial angiogenic stimulation J. J. Biol. Chem. 1992; 267: Full Text PDF PubMed Google Scholar), and changes of this can also the of the CCC members (7Lauf P.K. Bauer J. Adragna N.C. Fujise H. Zade-Oppen A.M.M. Ryu K.H. Delpire E. Am. J. Physiol. 1992; 263: C917-C932Crossref PubMed Google Scholar). et al. G. K.A. M.J. 1998; PubMed Scopus Google Scholar) reported that from endothelial cells in response to stimulation and of cells activation of the and also be in the of blood the the gradient that also that KCC3 be involved in the We also a of the KCC3 mRNA level in response to NKCC1 is up-regulated by TNFα (14Topper J.N. Wasserman S.M. Anderson K.R. Cai J. Falb D. Gimbrone Jr., M.A. J. Clin. Invest. 1997; 99: 2941-2949Crossref PubMed Scopus (56) Google Scholar), results suggest that KCC3 be a of KCC1 mRNA levels showed change in response to TNFα, the that KCC3 and NKCC1 are in response to NKCC1 has been reported to a of the growth in tobacco (8Harling H. Czaja I. Shell J. Walden R. EMBO J. 1997; 16: 5855-5866Crossref PubMed Scopus (25) Google Scholar), is involved in cell cycle we that KCC3 also be involved in cell cycle regulation. the pattern of KCC3 that of Donaldson D. M. J. Biol. Chem. 1996; 271: Full Text Full Text PDF PubMed Scopus Google Scholar), a involved in cell cycle KCC3 has been localized to 15q13 and the and This region has recently been linked to juvenile myoclonic epilepsy (17Elslie F.V. Rees M. Williamson M.P. Kerr M. Kjeldsen M.J. Pang K.A. Sundqvist A. Mögens L.F. Chadwick D. Richens A. Covanis A. Santos M. Arzimanoglou A. Panayiotopoulos C.P. Curtis D. Whitehouse W.P. Gardiner R.N. Hum. Mol. Genet. 1997; 6: 1329-1334Crossref PubMed Scopus (234) Google Scholar), the that KCC3 is a gene for this Payne J.A. Am. J. Physiol. 1997; PubMed Google Scholar) has that a KCC, as a Cl− in The is that the ion Clin. Genet. 1998; PubMed Scopus (25) Google Scholar) on inherited of epilepsy in C.M. Jr., R. Cell. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar), in the of for epilepsy J.C. Genet. PubMed Scopus Google Scholar), and of of potassium gene C. C. T.J. 1998; PubMed Scopus Google Scholar, C. R.J. M. Genet. 1998; PubMed Scopus Google Scholar, C. D. R.J. R. I. T. M.L. D. A. Anderson M. Genet. 1998; PubMed Scopus Google Scholar). we suggest that KCC3 be a gene for juvenile myoclonic epilepsy of further We Dr. for on differential display PCR and of pattern and and Dr. for We also the at the of the and and for of umbilical

Cloning, Characterization, and Chromosomal Location of a Novel Human K+-Cl− Cotransporter | Litlas