Interferon Receptor Signaling Pathways Regulating PD-L1 and PD-L2 Expression

Authors: Ángel García-Díaz, Daniel Sanghoon Shin, Blanca Homet Moreno, Justin D. Saco, Helena Escuin-Ordinas, Gabriel Abril Rodriguez, Jesse M. Zaretsky, Lu Sun, Willy Hugo, Xiaoyan Wang, Giulia Parisi, Cristina Puig-Saus, Davis Y. Torrejon, Thomas G. Graeber, Begonya Comin-Anduix, Siwen Hu‐Lieskovan, Robert Damoiseaux, Roger S. Lo, Antoni Ribas - Cell Reports 2017 cited by 1,911

(Cell Reports 19, 1189–1201; May 9, 2017) In the originally published version of this article, the PD-L1 promoter was mistakenly described to be cloned into the BglII/SacI sites of the pGL3 basic vector instead of the BglII site. Therefore, in Table S1 the corresponding primers should be: BglII PDL1 Prom F GGGGTTAGATCTTAGAAGTTCAGCGCGGGATA BglII PDL1 Prom R GGGGTTAGATCTCAGCGAGCTAGCCAGAGATACT The authors regret this error. Interferon Receptor Signaling Pathways Regulating PD-L1 and PD-L2 ExpressionGarcia-Diaz et al.Cell ReportsMay 09, 2017In BriefGarcia-Diaz et al. performed a small hairpin RNA screen and genetic and functional studies to map the signaling pathways that result in reactive PD-L1 and PD-L2 on melanoma cells upon interferon gamma exposure. The authors highlight the importance of the JAK1/JAK2-STAT1/STAT2/STAT3-IRF1 axis for clinical responses to PD-1 blockade therapy. Full-Text PDF Open Access